Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_102533 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Leukoaraiosis | ICD-10 | n/a (n/a) |
DBLink | Link to database | PMID | 28677780 |
Experimental Method | |||
Sample Type | Blood samples | Comparison | 6 samples from Leukoaraiosis (LA) cases and 6 matched controls |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GCTGCCAAAAGCATAACCAA ReverseCCCCTTTTCTGCTAAATGAACTCT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Mi, T, Luo, C, Hu, Y, Qu, C, Wang, X, Guo, S, Du, Y (2017). Spectrum construction of differentially expressed circular RNAs in patients with leukoaraiosis and function analysis of differentially expressed genes. Mol Med Rep, 16, 3:2563-2569. |